Review



pcat 3 basic vector  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    New England Biolabs pcat 3 basic vector
    Pcat 3 Basic Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 2842 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcat+3+basic+vector/BglII/pmc03889558-102-18-28
    Average 97 stars, based on 2842 article reviews
    pcat 3 basic vector - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Generated:

    Article Title: CREB3L1 Is a Metastasis Suppressor That Represses Expression of Genes Regulating Metastasis, Invasion, and Angiogenesis
    Article Snippet: .. Promoter sequences were generated for PTGES (5=-GACTCGAGG TCATTTGGGGTTAGGGGTGGTA and 3=-GAAGATCTGTCACACCG GGACTGAGAGTGAG) and fgfbp1 (5=-GACTCGAGGTCACACACTCT GGCTTTCCACACC and 3=-GAAGATCTGTCATCCAATGGCTTGAG ACTGC) and inserted into the pCAT 3 basic vector using XhoI and BglII restriction enzymes (New England BioLabs). ..

    Article Title: CREB3L1 Is a Metastasis Suppressor That Represses Expression of Genes Regulating Metastasis, Invasion, and Angiogenesis
    Article Snippet: .. Promoter sequences were generated for PTGES (5′-GACTCGAGGTCATTTGGGGTTAGGGGTGGTA and 3′-GAAGATCTGTCACACCGGGACTGAGAGTGAG) and fgfbp1 (5′-GACTCGAGGTCACACACTCTGGCTTTCCACACC and 3′-GAAGATCTGTCATCCAATGGCTTGAGACTGC) and inserted into the pCAT 3 basic vector using XhoI and BglII restriction enzymes (New England BioLabs). ..



    Similar Products

    97
    New England Biolabs pcat 3 basic vector
    Pcat 3 Basic Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcat+3+basic+vector/BglII/pmc03889558-102-18-28
    Average 97 stars, based on 1 article reviews
    pcat 3 basic vector - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    90
    Promega pcat ® 3-basic vector
    Pcat ® 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pmc02830064-55-30-34
    Average 90 stars, based on 1 article reviews
    pcat ® 3-basic vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pcat 3-basic vector
    Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.
    Pcat 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pmc00112291-92-47-50
    Average 90 stars, based on 1 article reviews
    pcat 3-basic vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pcat-3-basic vector
    Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.
    Pcat 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pm10025511-67-17-19
    Average 90 stars, based on 1 article reviews
    pcat-3-basic vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega pcat 3–basic vector
    Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.
    Pcat 3–Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pm09440701-57-22-25
    Average 90 stars, based on 1 article reviews
    pcat 3–basic vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.

    Journal:

    Article Title: Characteristics of the Adeno-Associated Virus Preintegration Site in Human Chromosome 19: Open Chromatin Conformation and Transcription-Competent Environment

    doi:

    Figure Lengend Snippet: Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.

    Article Snippet: The whole DHS-S1 was excised as an Sma I- Sma I fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the Sma I site of pCAT 3-basic vector (Promega).

    Techniques: Activity Assay, Construct, Clone Assay, Plasmid Preparation, Amplification, Transfection, Luciferase, Derivative Assay

    Enhancer activity of DHS-S1 is mainly located in the 181 to 353 region. (A) Graphic representation of the two DHS-S1 subregions, E1-S1 (nt 18 to 181) and E2-S1 (nt 181 to 353), whose transcriptional activity was tested in transient transfection assays. (B) Enhancer activity of E1-S1 and E2-S1 in 293 and HeLa cells. E1-S1 and E2-S1 were obtained as PCR fragments by using plasmid pRVK (see legend to Fig. ​Fig.1)1) as a template, and cloned in both orientations (indicated by the direction of the arrows) into plasmid pCAT 3-promoter either upstream of the SV40 promoter or downstream of the CAT gene (see the legend to Fig. ​Fig.4).4). Transfections, CAT assays, and normalization of the results were performed as described in the legend to Fig. ​Fig.4.4. Results are expressed as milliunits of CAT per 10 μg of cell extracts and as fold induction with respect to the pCAT 3-promoter vector. The data are means ± standard deviations of four independent experiments in which two different plasmid preparations were used.

    Journal:

    Article Title: Characteristics of the Adeno-Associated Virus Preintegration Site in Human Chromosome 19: Open Chromatin Conformation and Transcription-Competent Environment

    doi:

    Figure Lengend Snippet: Enhancer activity of DHS-S1 is mainly located in the 181 to 353 region. (A) Graphic representation of the two DHS-S1 subregions, E1-S1 (nt 18 to 181) and E2-S1 (nt 181 to 353), whose transcriptional activity was tested in transient transfection assays. (B) Enhancer activity of E1-S1 and E2-S1 in 293 and HeLa cells. E1-S1 and E2-S1 were obtained as PCR fragments by using plasmid pRVK (see legend to Fig. ​Fig.1)1) as a template, and cloned in both orientations (indicated by the direction of the arrows) into plasmid pCAT 3-promoter either upstream of the SV40 promoter or downstream of the CAT gene (see the legend to Fig. ​Fig.4).4). Transfections, CAT assays, and normalization of the results were performed as described in the legend to Fig. ​Fig.4.4. Results are expressed as milliunits of CAT per 10 μg of cell extracts and as fold induction with respect to the pCAT 3-promoter vector. The data are means ± standard deviations of four independent experiments in which two different plasmid preparations were used.

    Article Snippet: The whole DHS-S1 was excised as an Sma I- Sma I fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the Sma I site of pCAT 3-basic vector (Promega).

    Techniques: Activity Assay, Transfection, Plasmid Preparation, Clone Assay